Microsoft word - protocol updated for gensat9-18- 2009 for nick u.doc

NINDS GENSAT BAC TRANSGENIC PROJECT
Supported by NINDS Contract # N01-NS-7-2370
The Rockefeller University


1. BAC
Transgene
Construction
Shiaoching Gong
The plasmid, pLD53.SC2, used to generate EGFP lines is a derivative of pLD53. PLD53 was digested with BamHI and SacI to get rid of the tetAR and oriT origin and it was replaced by a NotI-SalI-SpeI adaptor. A 1.1 kb EGFP-PA was cloned into NotI and SalI sites, and a AscI-NotI-SwaI-SmaI multiple cloning site was then subcloned into the NotI site. The original NotI site was knocked out hereafter. This shuttle vector (pLD53.SC2) was digested with Asc/Sma1 and purified by running on a 1% low melting agarose gel. A 300-500 bp “A Box” fragment used for the homologous recombination was PCR amplified, digested with AscI and cloned into this predigested shuttle vector as described below. The plasmid, PLD53.SC.Cre, used to generate the Cre lines is also a derivative of pLD53. PLD53 was digested with BamHI and SacI to get rid of the tetAR and oriT origin and replaced by AscI-NotI-SwaI-SmaI-SalI adaptor. A 1.3 Kb fragment containing Cre-Intron-Cre and HSFVTK polyA was cloned into SmaI/SalI sites. The steps for A box cloning are the same as above. Transform the pLD53.SC2 or pLD53.SC.Cre shuttle vector into PIR1 or PIR2 E. coli cells (Invitrogen, C1010-10 or C1111-10), transform pSVRecA plasmid into DH5a E. coli cells (Invitrogen, cat no. 18258-012). Preparation of DNA for pLD53.SC2 and PSV-RecA

1. To grow pLD53.SC2, which possess an ampicillin resistant gene, pick a
single colony of pLD53.SC2 transformed Pir1 bacteria from the plate and inoculate 3 ml of Luria Broth medium supplemented with ampicillin (50 ug/ml). Incubate at 370C for 8 hours. Transfer this culture into 500 ml of Luria Broth medium supplemented with ampicillin (50 ug/ml) and incubate for 14-16 h at 370C with shaking at 300 rpm, 2. To grow pSV1.RecA, which possess a tetracycline resistant gene, pick a
single colony of pSV1.RecA transformed DH5a bacteria from the plate and inoculate 3 ml of Luria Broth medium supplemented with Tet (10 μg/ml) Incubate at 300C for 8 hours. Transfer this culture into 500 ml of Luria Broth medium supplemented with Tet (10 μg/ml) and incubate for 14-16 h at 300C with shaking at 300 rpm, 3. Spin down the bacteria at 4552 g for 30 mins at 40C (J6-MI Beckman-
4. Discard supernatant and resuspend bacterial pellet in 30 ml of P1 buffer
5. Add 30 ml of P2 buffer (Qiagen, Cat no. 19052), mix gently and incubate
6. Add 30 ml of ice-cold P3 buffer (Qiagen, Cat no. 19053), mix gently and
7. Spin at 20369 g for 30 mins at 40C (J-25I Beckman Avanti centrifuge,
8. Add 63 ml of isopropanol to supernatant, mix and collect DNA by
centrifugation Spin at 20300 g for 30 mins at 40C (J-25I Beckman Avanti centrifuge, JLA-16.250 rotor). Discard the supernatant and wash the pellet with 70% EtOH, dry at RT for 5-10 minutes and resuspend in 5 ml 1x TE. 9. Extract the DNA with an equal volume of phenol/chloroform (Sigma, Cat
10. Transfer the aqueous phase into another tube. Add 2 volumes of EtOH,
mix and collect DNA by centrifugation at 16417 g at 40 C for 30 minutes. 11. Discard the supernatant and wash the pellet with 70% EtOH. Dry the
pellet room temperature resuspend it in 400 μl of 1x TE. 12. Prepare Chroma Spin-400 Columns (Clontech, Cat no. K1323-2) by
Inverting the CHROMA spin-400 columns (Clontech) several times to resuspend the gel matrix completely. 13. Grasp the break-away end and lift off the top cap. Place the end of the
spin column into one of the 2-ml microcentrifuge tube. Hold them with a Falcon 14 ml polypropylene round-bottom tube (2059). 14. Centrifuge at 700 g for 5 mins at 40C (J6-MI Beckman-Coulter
15. Discard the 2-ml collection tube with the buffer. Place the spin column
into the second 2-ml microcentrifuge tube. Hold them with a Falcon 14 ml polypropylene round-bottom tube (2059). Carefully and slowly apply the DNA sample from step 10 into center of the column. Do not allow any sample to flow along the inner wall of the column. 16. Centrifuge at 700 g for 5 mins at 40C (J6-MI Beckman-Coulter
centrifuge, JS-4.2 rotor). Save the DNA and check its concentration.

Cloning of shuttle vectors
1. Prepare 100 ug (enough for 1000 ligation reactions) of the AscI/SwaI
digested pLD53.SC2 shuttle vector by incubation overnight in appropriate amounts of enzyme. Purify the digested vector, test the aliquot by ligation to determine background of undigested or single digested shuttle vector, redigest it until the background disappears. Aliquot and store this stock of predigested vector for use in “A box” cloning. 2. Prepare DNA from the selected BAC clone, resuspend the BAC DNA in
50 μl of 1x TE (10mM Tris, pH 8.0, 1 mM EDTA). PCR amplify a 300-500 bp “A box” homology regions from 1 μl of the BAC DNA (5’ primer incorporates AscI site and 3’ primer does not incorporate any restriction sites). Precipitate the DNA from the PCR reaction, and resuspend it with 86 ul of H2O, digest the products overnight with 4 ul of AscI, purify digested fragments by QIAquick PCR purification kit (Qiagen, Cat no. 28004). 3. Ligate the digested shuttle vector (100 ng) with each individual fragment
(60-80 ng), transform into PIR1 or PIR2 cells and plate the transformed cells on ampicillin (30ug/ml) plates. Use 20 ul of PIR1 or PIR2 cells + 2 ul of ligation mixture. 4. Test individual colonies for correct insertion by PCR (using R6K gamma
primer and 3’ end primer of the A Box). Prepare DNA for each positive shuttle vector and confirm these clones with restriction enzymes (AscI/SmaI) by comparing the digestion pattern with the vector. Since this shuttle vector contains a R6kr DNA replication origin, which can only replicate in bacteria expressing the pir replication protein, use of PIR1 or PIR2 cells from Invitrogen is strongly recommended. During this step, the “A” box fragment should not contain an internal Asc I site. If so, you have to incorporate a Mlu I site at the 5’ primer and digest your PCR product with Mlu I.
Preparation of the BAC shuttle vector

1. In a 50 ml Falcon tube, inoculate 15 ml of broth (7.5 ml of Luria Broth
and 7.5 ml of Terrific Broth) supplemented with 30ug/ml of ampicillin with one colony. Incubate at 370C overnight. 2. Harvest cells by centrifugation at 4552 g (J6-MI) for 20 minutes at 40C.
3. Discard the supernatant and add 500 ul of P1 buffer (Qiagen, Cat no.
19051) to resuspend the bacteria pellet. 4. Add 500 ul of P2 buffer (Qiagen, Cat no. 19052) to lysate the bacteria,
mix well and incubate at room temperature for 5 minutes. 5. Add 500 ul of ice-cold P3 buffer (Qiagen, Cat no. 19053) to neutralize
6. Pour the mixture into a 2.0 ml Eppendorf tube.
7. Centrifuge at 20617 g for 30 minutes.
8. Split volume between two (about 750ul each) 2.0 ml Phase Lock Gels
tubes (Fisher, Cat no. 0032005.152) and extract with an equal volume of
phenol/chloroform (Sigma, Cat no. P4557). Place tubes on an orbital
mixer for 5 minutes.
9. Transfer the top layer of each tube into a set of 2.0 ml sterile Eppendorf
10. Fill each tube with 100% EtOH and mix well.
11. Centrifuge at 20617 g for 30 minutes. Wash the pellet with 70% EtOH.
12. Dry and resolve both pellets with 200 ul of 1x TE.
13. Prepare Chroma Spin-400 Columns (Clontech, Cat no. K1323-2).
14. Transfer the DNA into the center of the spin column.
15. Centrifuge at 700 g for 5 minutes.
16. Transfer the DNA (200 μl) into another 1.5 ml Eppendorf tube, add 100
μl of 7.5 M ammonium acetate and 750 ul of 100% EtOH. 17. Place tubes in –700C freezer for 5 minutes and centrifuge at 20617 g for
30 minutes. Wash the pellet with 70% EtOH. 18. Resuspend the pellet with 10-15 μl of TE.
19. Check the DNA concentration on an agarose gel.

Preparation of BAC host cells by chemical transformation

1. Pick a single colony from the LB agar plate supplemented with
chloramphenicol (20 ug/ml) and inoculate 5ml of Luria Broth medium supplemented with chloramphenicol (20 ug/ml). Grow the cells overnight at 370C with shaking at 300 r.p.m. Dilute the overnight culture 1:100 with LB supplemented with chloramphenicol (20 ug/ml) and incubate for 3-4 hours at 370C to an OD600nm of 0.6-0.8. 2. Harvest the cells by centrifugation at 2560 g for 10 min at 40C.
3. Discard the supernatant and resuspend the bacterial pellet in 5 ml of ice-
cold 50mM CaCl2. Place on ice for 15 minutes and re-harvest as above. 4. Resuspend the pellet in 300 ul of ice-cold solution of 50 mM CaCl2 and
20% glycerol. Aliquot 100 ul into 3 tubes and save two of these butes at -700C. 5. Thaw an aliquot of pSV1.RecA DNA made in an earlier step and add 2-5
ul of this plasmid to 100 ul of the BAC host cells. Mix the tube gently and incubate for 30 min on ice. 6. Heat shock the bacteria by placing the tube in a 420C water bath for 50 s.
7. Add 1.0 ml of SOC medium to the mixture, transfer into a 1.5 ml
eppendorf tube and incubate for 1 h at 300C for 1 hour with shaking at 225 rpm. 8. Spread either 5 ul or 100 ul of the transformed BAC cells onto two LB
agar plate supplemented with chloramphenicol (20 ug/ml) and tetracyclin (10 μg/ml). Incubate overnight at 300C. 9. Pick a single colony from the plate and inoculate 5 ml of Luria Broth
medium supplemented with chloramphenicol (20 ug/ml) and tetracyclin (10 μg/ml). Incubate overnight at 300C with shaking at 300 rpm. 10. Transfer 1 or 2 ml of overnight culture into 50 ml of LB
supplemented chloramphenicol (20 ug/ml) and tetracyclin (10 μg/ml) in a 250 ml Corning centrifuge tube. Grow cells for 4-5 h with vigorous shaking at 300C to an OD600nm of 0.6-0.8. 11. Harvest cells by centrifugation at 2560 g at 4ºC for 10 min (J6-MI
Beckman Coulter centrifuge, JS-4.2 rotor). 12. Resuspend the pellet in an equal volume of 10% cold glycerol and
centrifuge at 2560 g for 10 min at 40C J6-MI Beckman Coulter centrifuge, JS-4.2 rotor). 13. Repeat steps 11 and 12 one time.
14. Decant the supernatant as much as possible and gently resuspend the
cells to a final volume of 200 ul with cold 10% glycerol. Glycerol solution can be difficult to decant. Make sure that your final dilution of cells is not greater than 200 ul. 15. Aliquot 40 ul into 5 Eppendorf tubes and store at -800C.
Transformation of BAC host competent cells via electroporation

1. Thaw 40 ul of pSV1.RecA transformed-BAC competent cells on ice and
mix with 2 ul of shuttle vector DNA (500 ng/ul). Place the mixture on ice for 1 min and transfer each sample to a cold 0.1 cm cuvette (BIO-RAD, Cat #1652089). Set BioRad Gene Pulser II apparatus at 25uF, the voltage to 1.8kV and pulse controller to 200Ω. 2. After electroporation, add 1.0 ml of SOC to each cuvette and transfer the
cell suspension to a 15 ml tube and incubate at 300C for 1.0 hour with shaking at 225 rpm. 3. Transfer sample into 5 ml of Luria Broth containing chloramphenicol (20
ug/ml) and tetracyclin (10 μg/ml) Tet (10 ug/ml), and ampicillin (50 ug/ml) and incubate at 300C overnight. 4. Spread 20 ul and 100 ul of the overnight culture onto Luria Broth plates
containing chloramphenicol (20 ug/ml) and ampicillin (50 ug/ml) and incubate overnight at 430C.
Identification and characterization of cointegrates

1. Use PCR to check 8 to 10 individual colonies for the presence of the
modified BAC (cointegrate). Successful modification of the BAC will allow for the amplification of two specific PCR products. The first product is generated through the use of a forward 5’ cointegrate primer (a sequence located upstream of the 5’ end of the A-box) and a reverse 3’ marker primer (EGFP, Cre). The second product is generated through the use of a forward of 5’ primer of R6kг ori and a reverse 3’ cointegrate primer (a sequence located downstream of the 3’ end of the A-box). 2. Once successfully modified BAC clones are identified, they should be
transferred to a master plate. This plate is used for latter amplification, re-checks, etc. 3. From the master plate, pick a tiny portion of a confirmed colony and
inoculate 3 ml of Luria Broth medium supplemented with chloramphenicol (20 ug/ml) and ampicillin (50 ug/ml). Incubate for 8 h at 370C with shaking at 300 rpm. 4. Mix 800 ul overnight culture with 200 ul 100% glycerol and store at -
5. The modified BACs can be further confirmed by Southern blot analysis if
needed. Prepare DNA by standard alkaline method and digest with unique restriction enzymes. Compare the resulting pattern with those from wild-type BAC and shuttle vector DNA by Southern blot analysis. Use the “A box” as a hybridization probe. The correct cointegrates hybridize to two fragments due to the introduction of an additional restriction site with the recombination cassette. The wild-type BAC and the shuttle vector hybridize to only one fragment.
Primers for Identification and characterization of cointegrates

Reverse (3’) EGFP:
CGCCCTCGCCGGACACGCTGAAC
Reverse (3’) Cre:
CAACTTGCACCATGCCGCCCACGAC
Forward (5’) R6K gamma:
CAGGTTGAACTGCTGATCTTCAGATCC

2. BAC DNA Purification for Transgenesis Double acetate
precipitation and CsCl gradient method
Shiaoching Gong

General considerations
Never vortex cells or DNA suspensions.
Use wide bore pipette tips to avoid damaging DNA during solution transfer.
Exercise caution when handling ethidium bromide; a potent mutagen.
1. Pick a single colony of transformed bacteria from a freshly streaked
chloramphenicol (20 ug/ ml) and ampicillin (50 ug/ ml) agar plate; inoculate 3 ml of Luria Broth medium containing chloramphenicol and ampicillin (same conc as agar). Incubate at 370C for 8 hours. 2. Transfer 15l-50 μl of inoculated broth (depends on the cell density) into
500 ml of Luria Broth containing chloramphenicol and ampicillin (conc as above); incubate at 300C for 14 – 16 hours 3. Spin down the bacteria at 4552 g for 30 mins at 40C (J6-MI Beckman-
Coulter centrifuge, JS-4.2 rotor). Remove all traces of supernatant by inverting the open centrifuge tube until all medium has been drained. 4. Resuspend cells in 40 ml of 10 mM EDTA, pH 8.0 by pipetting and
5. Add 80 ml of alkaline lysis solution (0.2N NaOH in 1% SDS: 2 ml of
10N NaOH, 10 ml of 10% SDS into 88 ml dH2O). Mix by *very* gently 6. Add 60 ml of cold 2M KOAc (50 ml of 7.5M KOAc, 23 ml of glacial
acetic acid and 127 ml of dH2O, stored at 40C). Mix by *very* gently swirling and incubate on ice for 5 min. Spin at 20369 g for 30 mins at 40C (J-25I Beckman Avanti centrifuge, JLA-16.250 rotor). 7. Transfer supernatant into a 250 ml bottle, add 180 ml of isopropanol. Mix
by gently swirling. Spin at 4552 g for 30 mins at 40C (J6-MI centrifuge, JS-4.2 rotor). Decant the supernatant. 8. Dissolve the DNA pellet in 18 ml of 10:50 TE (1ml of 1M Tris, 10 ml of
0.5M EDTA into 89 ml dH2O). Add 9 ml of 7.5M KOAc and mix and 9. Thaw solution and centrifuge at 4355 g for 10 mins at 40C (J-25I
Beckman Avanti centrifuge, JA-25.50 rotor). 10. Transfer supernatant to a new tube and add 2.5 volume of ethanol. Spin
at 20369 g for 30 mins at 40C to precipitate the DNA (J-25i Beckman Avanti centrifuge, JLA-16.250 rotor). 11. Decant supernatant and gently resuspend pellet (while still moist) in 4.4
ml of TE. Dissolve, as best possible, 10.2 g of CsCl in another 4.4 ml of TE. *Gently* mix CsCl solution with 4.4 ml of DNA until the CsCl has dissolved. Add 0.2 ml ethidium bromide solution (10 mg/ ml dH20) and mix immediately. Spin at 4552 g for 10 mins at 40C to remove debris (J6-MI centrifuge, JS-4.2 rotor). 12. Remove the supernatant and load into a Beckman Quick-Seal tube (16 x
76 mm, #342413) using a syringe and 18-gauge needle. Seal tubes *carefully* and place in a NVT65 rotor. (It is very important to equilibrate the tubes to be centrifuged in opposing positions: weigh them very carefully to make sure they do not differ by more than 0.05g). Spin at341,650 g overnight (>8 hours) at 180C. 13. Remove tubes from rotor carefully, taking care not to disturb the
gradient. Use a 23-gauge needle to poke a hole in the top of the tube. Utilizing a UV light, carefully remove the band (choose bottom band if there are two) with an 18-gauge needle with the needle bevel up. Take the band and no more (usually about 200 μl). Transfer it to a 15 ml tube and bring it up to 2 ml with TE. Extract 4-5 times with NaCl-saturated butanol (20 ml of 3M NaCl in 100 ml of butanol) until there is no more orange color. (To extract add equal volume of NaCl-saturated butanol to TE solution, mix gently, let mixture sit 30 sec to allow for separation, remove and discard top layer.) 14. Add 1 ml of H2O to DNA solution and then 2.5 - 3.0 volumes of EtOH
and mix. Place at -200C for 30 mins. Spin solution at 16417 g for 30 mins at 40C to precipitate the DNA (J-25i Beckman Avanti centrifuge, JA-25.50 rotor). Resuspend DNA in 0.5 ml of 0.3M NaOAc. Transfer DNA to 1.5 ml Eppendorf tube and add 1 ml EtOH. Spin down the DNA at 20617 g for 30 mins at 40C (Eppendorf microcentrifuge model 5417R). Discard the supernatant, fill the tube with 70% EtOH and allow the tube sit at room temperature for 5 mins. Spin the DNA again as in previous step but shorten time to 10 mins. Dry the pellet at RT for 1 min; use paper towel to get rid of the trace amount of ethanol. Resuspend DNA gently in 20-40 μl of TE. Place DNA in 370C incubator for 20-30 min. You are likely to get 5-20 ug of BAC DNA. You should store BAC DNA at 40C. (Do not store it at -200C!!!) 15. Check the DNA on pulse field gel and determine the concentration.
16. Digest the BAC DNA with PI-SceI (New England Biolabs, Cat #
R0696S): Add together 5 – 10 μl (about 100 ng) of BAC DNA, 2 μl of PI-SceI enzyme, 5 μl of 10x buffer and dH2O to produce a final volume of 50 μl. Incubate in a 370C incubator for 3 to 4 hours. 17. To dialyze the DNA, start by placing 20 ml of injection buffer (recipe
below) into a sterile Petri dish and float a 25 mm, 0.025 um filter (Millipore, Cat. # VSWP02500) on top with the shiny side up. Load the 50 μl of digested DNA on the top of the filter and cover the Petri dish with lid. Allow set-up to sit at RT for 4-6 hours. Transfer the DNA-containing solution on top of the filter to a microcentrifuge tube and add enough injection buffer to return solution to original volume of 50 μl. 18. Check the DNA on pulse field gel again to confirm the concentration.



Injection buffer for BAC
10 mM Tris, pH 7.5
0.1 mM EDTA
100 mM NaCl

Primers for genotyping tail DNA

The PCR primers for EFGP Lines:
EGFP-5’ CCTACGGCGTGCAGTGCTTCAGC EGFP-3’ CGGCGAGCTGCACGCTGCCGTCCTC The PCR primers for Cre Lines:

Cre-5’
GGACATGTTCAGGGATCGCCAGGCG
Cre-3’
GCCAGATTACGTATATCCTGGCAGCG


References

1. Gong, S. Yang, X.W., Li, C. and Heintz, N. Highly efficient modification
of bacterial artificial chromosomes (BACs) using novel shuttle vectors containing the R6K gamma origin of replication. Genome Res 12, 1992-8 (2002). 2. Gong, S., C. Zheng, M. Doughty, K. Losos, N. Didkovsky, U. B.
Schambra, N. J. Nowak, A. Joyner, G. Leblanc, M.E. Hatten and N. Heintz (2003). A gene expression atlas of the central nervous system based on bacterial artificial chromosomes. Nature 425:917-925 3. Gong, S., M. Doughty, C. R. Harbaugh, A. Cummins, M. E. Hatten, N.
Heintz and C. R. Gerfen. Targeting Cre Recombinase to Specific Neuron Populations With Bacterial Artificial Chromosome Constructs. J. Neurosci, In press.

Source: http://www.gensat.org/BACProtocol.pdf