FIRST MOLECULAR EVIDENCE OF RICKETTSIA SPP. IN HUMAN BLOOD SAMPLES, WITH CLINICAL AND EPIDEMIOLOGICAL PROFILE OF TICK- BORNE DISEASE IN THE MATO GROSSO DO SUL STATE
Izaias Pereira da Costa1, Robson Ferreira Cavalcante de Almeida1, Elder Yanazi Oda1, Barbara Guimarães Csordas1, Bruno Martins Ferreira de Andrade2, Rodrigo Casquero Cunha1, Tomé Gustavo Marques de Souza3, Renato Andreotti4*
1FAMED – Universidade Federal de Mato Grosso do Sul - UFMS, Campo Grande, MS.
2Neurosurgery Service of Santa Casa. 3Rheumatology Department of NHU/UFMS.
Patient 44 years, male, farm worker, non-drinker and non-smoker, born and residing in MS, previously healthy, was admitted for investigation of fever (38.5 to 40 °) recurrent for 1 year, associated with confusion, diplopia, confused speech ("dragged"), axial and appendicular ataxia, imbalance and difficulty while walking with "dance of the tendons;" generalized tonic-clonic seizures, dysphagia transmission (including liquid), asymmetric migratory arthritis of large joints (mainly left shoulder and right knee) and later small joints (proximal interphalangeal and wrists). By verification of positive epidemiology for tick borne disease, associated with the patient's report of contact and constant tick-bite, was suggested diagnosis of Lyme disease-like. The patient was treated, in home care, with ceftriaxone 1g 12/12 h for 30 days and then maintained with doxycycline 100 mg 12/12h, with clinical remission. As the patient had complete remission with this treatment, he stopped using the drug, and after stopped developed recurrent disease with neurological and articulate signs. It was portrayed with the same scheme, with full recovery and remains asymptomatic and with doxycycline use. Later it was verified that the Lyme-like serology was negative for antibodies against Borrelia spp. Having new clinical recurrence, after discontinuation of doxycycline, we send samples for PCR of Borrelia spp., Babesia spp. and Ricketsia spp. In laboratory, the blood sample was subjected to DNA extraction, protocol using a combination of guanidine isothiocyanate and phenol. The extraction buffer was prepared the day before the procedure, adding one volume of phenol in an amount of guanidine isothiocyanate (6 M) and incubated at 4 °C overnight. The DNA was incubated overnight at 4 ⁰C for rehydration. The samples were then quantified GeneQuantTM spectrophotometer (Pharmacia) and the concentration of total DNA from each sample were adjusted to 200 ng µL-1. The PCR was utilized for detection
(GCTTCCTTAAAATTCAATAAATCAGGAT) which target a partial sequence synthase citrate gene (gltA), delimiting a 401-bp fragment. The sequence of this gene is relatively well conserved in all Rickettsia spp. Positive sample was subjected to second PCR with primers Rr 190.70p
(AGTGCAGCATTCGCTCCCCCT) that amplified a fragment of 732 bp of the ompA gene of Rickettsia spp. Key words: Tick borne diseases, Borrelia spp., Ricketssia spp., rickettsiosis. Financial support: UFMS; CAPES; CNPq; FUNDECT; EMBRAPA.
Debate and Forensics in Kansas. In the state of Kansas the Kansas State High School Athletic Association has divided Debate and Forensics into Fall semester and Spring semester activities. Policy Debate begins in September and ends in January. Forensics begins in February and ends in May. Students have the opportunity to compete in both activities, and qualify for state championship tournament
CROWS NEST 64 Atchison St Crows Nest NSW 2065EYE CLINIC FOR ANIMALS Ph: (02) 9436 4884 • Fax: (02) 9906 5710 Jeffrey S. Smith BVSc, FACVScCameron J.G. Whittaker444 Liverpool Rd (Hume Highway), South Strathfield NSW 2136 www.eyeclinicforanimals.com.au Ph: (02) 975 88 666 4 • Fax: (02) 975 88 880 Dry Eye is a condition in which the tear glands What is Dry Eye (KCS) are unable